National Collection of Yeast Cultures
+44-(0)1603-255274
+44-(0)1603-458414
ncyc@ncyc.co.ukView Yeast Characteristics
200 - Saccharomyces cerevisiae
| Please login or register to buy yeasts online from NCYC |
Print Friendly Version Expand All | Collapse All |
Temperature:
| Optimum Temperature (Degrees Celcius): | |
|---|---|
| Miniumum Temperature(Degrees Celcius): | |
| Maximum Temperature (Degrees Celcius): |
Cells:
| Shape: | Oval |
|---|---|
| Min Broth Breadth: | 4 |
| Max Broth Breadth: | 6 |
| Min Broth Length: | 4 |
| Max Broth Length: | 9 |
| Min Agar Breadth: | 3 |
| Max Agar Breadth: | 5 |
| Min Agar Length: | 3 |
| Max Agar Length: | 8 |
| Arrangement: | Pairs |
| Colour on Agar: | Cream |
| Surface on Agar: | Shiny |
| Texture on Agar: | Smooth |
| Deposit in Broth: | Unknown |
| Ring in Broth: | Absent |
| Ring Colour: | Unknown |
| Pellicle in Broth: | Absent |
| Pellicle Appearance: | N/A |
| Pellicle Habitat: | N/A |
Cell Division:
| Budding: | Multipolar |
|---|---|
| Fission: | Absent |
Filamentous Growth:
| Pseudomycelium: | Absent |
|---|---|
| Pseudomycelium Branch: | N/A |
| Pseudomycelium Form: | N/A |
| Blastospores: | N/A |
| Blastospore Shape: | N/A |
| Blastospore Location: | N/A |
| Blastospore Habitat: | N/A |
| True Mycelium: | Absent |
| Clamp Connections: | Absent |
Asexual Spores:
| Ballistospores: | Absent |
|---|---|
| Arthrospores: | Absent |
| Endospores: | Absent |
| Chlamydospores: | Absent |
Sexual Spores:
| Ascospores: | Present |
|---|---|
| Ascospore Shape: | Round |
| Ascospore Wall: | Smooth |
| Ascospore No Per Ascus: | Unknown |
| Ascus Shape: | Oval |
| Conjugation: | Present |
| Teliospores: | Absent |
| Teliospore Shape: | N/A |
| Assay: | Unknown |
|---|---|
| Salt Tolerant: | Unknown |
| Killer: | No |
| Plasmid: | Unknown |
| Glucose: | + |
|---|---|
| Galactose: | + |
| Sucrose: | + |
| Maltose: | + |
| Cellobiose: | Unknown |
| Trehalose: | Unknown |
| Lactose: | - |
| Melibiose: | - |
| Raffinose: | + |
| Melizitose: | Unknown |
| Inulin: | Unknown |
| Soluble Starch: | - |
| Xylose: | Unknown |
| A M D Glucoside: | Unknown |
| Glucose: | + |
|---|---|
| Galactose: | + |
| Sorbose: | Unknown |
| Sucrose: | + |
| Maltose: | + |
| Cellobiose: | - |
| Trehalose: | + |
| Lactose: | - |
| Melibiose: | - |
| Raffinose: | Unknown |
| Melizitose: | + |
| Inulin: | - |
| Soluble Starch: | - |
| Xylose: | - |
| L Arabinose: | Unknown |
| D Arabinose: | - |
| Ribose: | - |
| Rhamnose: | Unknown |
| Ethanol: | + |
| Glycerol: | + |
| Erythritol: | - |
| Ribitol: | Unknown |
| Galactitol: | Unknown |
| Mannitol: | - |
| Sorbitol: | - |
| A M D Glucoside: | - |
| Salicin: | - |
| Lactic Acid: | Unknown |
| Succinic Acid: | - |
| Citric Acid: | Unknown |
| Inositol: | Unknown |
| Gluconolactone: | Unknown |
| Glucosamine: | Unknown |
| Methanol: | Unknown |
| Xylitol: | Unknown |
| NH4 2SO4: | + |
|---|---|
| KNO3: | - |
| Ethylamine: | - |
| Cadaverine: | Unknown |
| Lysine: | Unknown |
| Vitamin Free Growth: | + |
|---|---|
| Cyclohex 100ppm: | - |
| Cyclohex 1000ppm: | - |
| 50% Glucose Growth: | Unknown |
| 60% Glucose Growth: | - |
| Lipolytic: | - |
| Acid Production: | Unknown |
| 37c Growth: | Unknown |
| 40c Growth: | Unknown |
| Arbutin Hydrolysis: | + |
| Urease Activity: | Unknown |
| Starch Production: | Unknown |
| Acid Tolerant: | Unknown |
| File: | Sequence Data: |
|---|---|
| NCYC200_26SrDNA.fas | >Contig_1
CATCCTTGACTTACGTCGCAGTCCTCAGTCCCAGCTGGC AGTATTCCCACAGGCTATAATACTTACCGAGGCAAGCTA CATTCCTATGGATTTATCCTGCCACCAAAACTGATGCTG GCCCAGTGAAATGCGAGATTCCCCTACCCACAAGGAGCA GAGGGCACAAAACACCATGTCTGATCAAATGCCCTTCCC TTTCAACAATTTCACGTACTTTTTCACTCTCTTTTCAAA GTTCTTTTCATCTTTCCATCACTGTACTTGTTCGCTATC GGTCTCTCGCCAATATTTAGCTTTAGATGGAATTTACCA CCCACTTAGAGCTGCATTCCCAAACAACTCGACTCTTCG AAGGCACTTTACAAAGAACCGCACTCCTCGCCACACGGG ATTCTCAC |

Strain Information
Special Applications