• Yeast Search


    Search
  • Full Catalogue
  • Type Strains
  • Brewing Strains

    Search
  • Baking Strains
  • Spec. Application
    Strains +

    Search
  • Genetically Defined Strains
  • SGRP Strains +/-

NCYC 4530

Saccharomyces cerevisiae

Equivalent Strain Designations

#72 Gjelland, k137

Depositor

Lars Gjelland via Lars Marius Garshol, European Farmhouse Yeast Registry

Deposit Date

September 2025

Habitat

Mixed (3 strain) traditional farmhouse brewing yeast culture from Gjelland, Norway

Nagoya Protocol Restrictions

No known Nagoya Protocol restrictions for this strain.

Details

4530-x400-from-post-LN2-plate.png
Saccharomyces cerevisiae

A licence fee may be applied to products purchased for commercial use. Find out more information.



Add to Basket



Key Information

Aerobic Utilisation and Growth

  • Glucose+
  • Galactose+
  • Sorbose-
  • Sucrose+
  • Maltose+
  • Cellobiose-
  • Trehalose-
  • Lactose-
  • Melibiose-
  • Raffinose+
  • Melezitose+
  • InulunWeak
  • Soluble Starch-
  • Xylose-
  • L Arabinose-
  • D Arabinose-
  • Ribose-
  • Rhamnose-
  • Ethanol-
  • Glycerol-
  • Erythritol-
  • Ribitol-
  • Galactitol-
  • Mannitol-
  • Sorbitol-
  • AMD Glucoside-
  • Salicin-
  • Lactic Acid-
  • Succinic Acid-
  • Citric Acid-
  • Inositol-
  • Gluconolactone-
  • Glucosamine-
  • Methanol-
  • Xylitol-

Strain Information

  • Information

    Mixed (3 strain) traditional farmhouse brewing yeast culture from Gjelland, Norway

  • DepositorLars Gjelland via Lars Marius Garshol, European Farmhouse Yeast Registry
  • Deposit Name#72 Gjelland, k137
  • Month of depositSeptember
  • Deposit Year2025
  • HabitatMixed (3 strain) traditional farmhouse brewing yeast culture from Gjelland, Norway
  • Equivalent Strain Designations#72 Gjelland, k137
  • Referencehttp://www.garshol.priv.no/download/farmhouse/kveik.html

     

Physical Characteristics

  • Optimum TemperatureUnknown
  • Miniumum TemperatureUnknown
  • Maximum TemperatureUnknown

Cells

  • ShapeRound to Oval
  • Min Broth Breadth (µm)2
  • Max Broth Breadth (µm)5
  • Min Broth Length (µm)2
  • Max Broth Length (µm)7
  • Min Agar Breadth (µm)2
  • Max Agar Breadth (µm)5
  • Min Agar Length (µm)2
  • Max Agar Length (µm)7
  • ArrangementSingle, in pairs and clumps
  • Colour on AgarWhite
  • Surface on AgarDull
  • Texture on AgarSmooth
  • Deposit in BrothNon-Flocculent
  • Ring in BrothAbsent
  • Ring ColourUnknown
  • Pellicle in BrothAbsent
  • Pellicle AppearanceAbsent
  • Pellicle HabitatUnknown

Cell Division

  • BuddingMultipolar
  • FissionAbsent

Filamentous Growth

  • PseudomyceliumAbsent
  • Pseudomycelium BranchUnknown
  • Pseudomycelium FormUnknown
  • BlastosporesAbsent
  • Blastospore ShapeUnknown
  • Blastospore LocationUnknown
  • Blastospore HabitatUnknown
  • True MyceliumAbsent
  • Clamp ConnectionsAbsent

Asexual Spores

  • BallistosporesAbsent
  • AthrosporesAbsent
  • EndosporesAbsent
  • ChlamydosporesAbsent

Sexual Spores

  • AscosporesPresent
  • Ascospore ShapeRound
  • Ascospore WallUnknown
  • Ascospores No Per Ascus3-4
  • Ascus ShapeRound
  • ConjugationAbsent
  • TeliosporesAbsent
  • Teliospore ShapeUnknown

Miscellaneous

  • AssayUnknown
  • Salt TolerantUnknown
  • KillerUnknown
  • PlasmidUnknown

Semi-Anaerobic Fermentation

  • Glucose+
  • Galactose+
  • Sucrose+
  • Maltose+
  • Cellobiose-
  • Trehalose-
  • Lactose-
  • Melibiose-
  • Raffinose-
  • Melizitose-
  • Inulin-
  • Soluble Starch-
  • Xylose-
  • AMD Glucoside-

Aerobic Utilisation and Growth - Sole Sources of Nitrogen

  • NH4 2SO4+
  • KNO3Weak
  • EthylamineUnknown
  • Cadaverine+
  • Lysine+

Other

  • Vitamin Free GrowthUnknown
  • Cyclohex 100Unknown
  • Cyclohex 1000Unknown
  • Glucose Growth 50Unknown
  • Glucose Growth 60Unknown
  • LipolyticUnknown
  • Acid ProductionUnknown
  • Growth 37+
  • Growth 40Unknown
  • Arbutin HydrolysisUnknown
  • Urease ActivityUnknown
  • Starch ProductionUnknown
  • Acid TolerantUnknown

Brewing Information

  • DescriptionUnknown
  • DepositUnknown
  • HeadUnknown
  • AttenuationUnknown
  • ClarityUnknown
  • Fermentation RateUnknown
  • FlocculenceUnknown

26S rDNA seq

AGGAAAAGAAACCAACCGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGTACCTTC
GGTGCCCGAGTTGTAATTTGGAGAGGGCAACTTTGGGGCCGTTCCTTGTCTATGTTCCTTGGAACAGGACGTCATAGAG
GGTGAGAATCCCGTGTGGCGAGGAGTGCGGTTCTTTGTAAAGTGCCTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTC
TAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGA
AAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGTGTTTTGT
GCCCTCTGCTCCTTGTGGGTAGGGGAATCTCGCATTTCACTGGGCCAGCATCAGTTTTGGTGGCAGGATAAATCCATAG
GAATGTAGCTTGCCTCGGTAAGTATTATAGCCTGTGGGAATACTGCCAGCTGGGACTGAGGACTGCGACGTAAGTCAAG
GATGCTGGCATAATGGTTATATGCCGCCCGTCTT

Genomic Sequence Data

No data