• Yeast Search


    Search
  • Full Catalogue
  • Type Strains
  • Brewing Strains

    Search
  • Baking Strains
  • Spec. Application
    Strains +

    Search
  • Genetically Defined Strains
  • SGRP Strains +/-

NCYC 1416

Zygosaccharomyces bailii

Taxon Synonyms

Zygosaccharomyces bailii

Equivalent Strain Designations

ATCC 58445, CBS 680, CCRC 21525, CECT 10674, CECT 11997, DBVPG 6287, IFO 1098, IGC 2470, NRRL Y-2227.

Depositor

CBS

Deposit Date

March 1982

Habitat

Brewery, Tokyo.

Nagoya Protocol Restrictions

No known Nagoya Protocol restrictions for this strain.

Details

1416-4.jpg1416-1.jpg

A licence fee may be applied to products purchased for commercial use. Find out more information.



Add to Basket



Key Information

Aerobic Utilisation and Growth

  • Glucose+
  • Galactose-
  • Sorbose-
  • Sucrose-
  • Maltose-
  • Cellobiose-
  • Trehalose+
  • Lactose-
  • Melibiose-
  • Raffinose-
  • Melezitose-
  • Inulin-
  • Soluble Starch-
  • Xylose-
  • L Arabinose-
  • D Arabinose-
  • Ribose-
  • Rhamnose-
  • Ethanol-
  • GlycerolWeak/Latent
  • Erythritol-
  • Ribitol+
  • Galactitol-
  • Mannitol+
  • Sorbitol+
  • AMD Glucoside-
  • Salicin-
  • Lactic Acid-
  • Succinic Acid-
  • Citric Acid-
  • Inositol-
  • Gluconolactone+
  • Glucosamine-
  • Methanol-
  • XylitolUnknown

Strain Information

  • Information

    Type strain of Saccharomyces bailii. Type strain of Zygosaccharomyces bailii.

  • DepositorCBS
  • Deposit NameZygosaccharomyces bailii
  • Month of depositMarch
  • Deposit Year1982
  • HabitatBrewery, Tokyo.
  • Equivalent Strain DesignationsATCC 58445, CBS 680, CCRC 21525, CECT 10674, CECT 11997, DBVPG 6287, IFO 1098, IGC 2470, NRRL Y-2227.
  • ReferenceLindner P . Saccharomyces farinosus und Saccharomyces bailii. Zwei neue Hefenarten aus Danziger Jopenbier. Wochenschr. Brau. 11: 153-156, 1894. James SA , et al. Genetic interrelationship among species of the genus Zygosaccharomyces as revealed by small-subunit rRNA gene sequences. Yeast 10: 871-881, 1994. James SA , et al. Use of an rRNA internal transcribed spacer region to distinguish phylogenetically closely related species of the genera Zygosaccharomyces and Torulaspora. Int. J. Syst. Bacteriol. 46: 189-194, 1996. Kurtzman CP , Robnett CJ . Identification and phylogeny of ascomycetous yeasts from analysis of nuclear large subunit (26S) ribosomal DNA partial sequences. Antonie van Leeuwenhoek 73: 331-371, 1998. Kurtzman, Yeast 6: 213-219, 1990 (DNA).

Physical Characteristics

  • Optimum Temperature28
  • Miniumum Temperature15
  • Maximum Temperature28

Cells

  • ShapeUnknown
  • Min Broth Breadth (µm)Unknown
  • Max Broth Breadth (µm)Unknown
  • Min Broth Length (µm)Unknown
  • Max Broth Length (µm)Unknown
  • Min Agar Breadth (µm)4
  • Max Agar Breadth (µm)9
  • Min Agar Length (µm)9
  • Max Agar Length (µm)19
  • ArrangementPairs
  • Colour on AgarCream
  • Surface on AgarShiny
  • Texture on AgarWrinkled
  • Deposit in BrothFlocculent
  • Ring in BrothAbsent
  • Ring ColourUnknown
  • Pellicle in BrothAbsent
  • Pellicle AppearanceUnknown
  • Pellicle HabitatUnknown

Cell Division

  • BuddingMultipolar
  • FissionAbsent

Filamentous Growth

  • PseudomyceliumIll Formed
  • Pseudomycelium BranchIrregularly Branched
  • Pseudomycelium FormUnknown
  • BlastosporesUnknown
  • Blastospore ShapeUnknown
  • Blastospore LocationUnknown
  • Blastospore HabitatUnknown
  • True MyceliumAbsent
  • Clamp ConnectionsAbsent

Asexual Spores

  • BallistosporesAbsent
  • AthrosporesAbsent
  • EndosporesAbsent
  • ChlamydosporesAbsent

Sexual Spores

  • AscosporesAbsent
  • Ascospore ShapeUnknown
  • Ascospore WallUnknown
  • Ascospores No Per AscusN/A
  • Ascus ShapeN/A
  • ConjugationAbsent
  • TeliosporesAbsent
  • Teliospore ShapeUnknown

Miscellaneous

  • AssayNo
  • Salt Tolerant -
  • KillerUnknown
  • PlasmidUnknown

Semi-Anaerobic Fermentation

  • Glucose+
  • Galactose-
  • Sucrose-
  • Maltose-
  • Cellobiose-
  • Trehalose-
  • Lactose-
  • Melibiose-
  • Raffinose-
  • Melezitose-
  • Inulin-
  • Soluble Starch-
  • XyloseUnknown
  • AMD Glucoside-

Aerobic Utilisation and Growth - Sole Sources of Nitrogen

  • NH4 2SO4+
  • KNO3-
  • Ethylamine+
  • CadaverineUnknown
  • LysineUnknown

Other

  • Vitamin Free Growth-
  • Cyclohex 100-
  • Cyclohex 1000-
  • Glucose Growth 50+
  • Glucose Growth 60-
  • Lipolytic-
  • Acid ProductionWeak/Latent
  • Growth 37-
  • Growth 40-
  • Arbutin Hydrolysis-
  • Urease Activity-
  • Starch Production-
  • Acid TolerantUnknown

26S rDNA seq

GGAGTGAAAAGAAACCAACCGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGTACC
TTCGGTGCCCGAGTTGTAATTTGTAGAAGGCGACTCTGGGGCTGGTCCTTGTCTATGTTCCTTGGAACAGGACGTCATG
GAGGGTGAGAATCCCGTATGGCGAGGATCCCAGTTCTTTGTAGAGTGCCTTCGAAGAGTCGAGTTGTTTGGGAATGCAG
CTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGA
TGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGTGTTT
TGCGCCCCTCGCCTCTCGTGGGTGGGGGAATCTCGCAGTTCACTGGGCCAGCATCAGTTTTGGCGGCAGGATAAATCCC
TGGGAATGTAGCTCTACCACTTCGTGGCGGACGAACTTATAGTCCAGGGGAATACTGCCAGCTGGGACTGAGGAATGCG
ACTTTTAGTCAAGGATGCTGGCATAATGGTTATATGCCGCCCG

Genomic Sequence Data

No data