• Yeast Search


    Search
  • Full Catalogue
  • Type Strains
  • Brewing Strains

    Search
  • Baking Strains
  • Spec. Application
    Strains +

    Search
  • Genetically Defined Strains
  • SGRP Strains +/-

NCYC 2563

Solicoccozyma terrea

Taxon Synonyms

Cryptococcus terreus

Equivalent Strain Designations

ATCC 11799, CBS 1895, DBVPG 6012, MUCL 30418, NCYC 393, NRRL YB-4231, VKM Y-2253.

Depositor

CBS

Deposit Date

August 1994

Habitat

Soil, of garden, New Zealand

Details

QIB230116_ABRA_02-9_NCYC2563_04.jpgCryptococcus terreus

A licence fee may be applied to products purchased for commercial use. Find out more information.



Add to Basket



Key Information

Aerobic Utilisation and Growth

  • Glucose+
  • Galactose+
  • Sorbose+
  • Sucrose-
  • Maltose+
  • Cellobiose+
  • Trehalose+
  • Lactose+
  • Melibiose-
  • Raffinose-
  • MelezitoseWeak/Latent
  • Inulun-
  • Soluble Starch+
  • Xylose+
  • L Arabinose+
  • D Arabinose+
  • Ribose+
  • Rhamnose+
  • Ethanol-
  • Glycerol-
  • Erythritol-
  • Ribitol+
  • Galactitol+
  • Mannitol+
  • Sorbitol+
  • AMD Glucoside-
  • Salicin+
  • Lactic Acid-
  • Succinic AcidWeak/Latent
  • Citric Acid-
  • Inositol+
  • Gluconolactone+
  • Glucosamine+
  • Methanol-
  • Xylitol+

Strain Information

  • InformationUnknown
  • DepositorCBS
  • Deposit NameCryptococcus terreus
  • Month of depositAugust
  • Deposit Year1994
  • HabitatSoil, of garden, New Zealand
  • Equivalent Strain DesignationsATCC 11799, CBS 1895, DBVPG 6012, MUCL 30418, NCYC 393, NRRL YB-4231, VKM Y-2253.
  • Referencedi Menna ME. (1954). Cryptococcus terreus n. sp., from soil in New Zealand. J. Gen. Microbiol. 11: 195-197. Fell JW , et al. (2000). Biodiversity and systematics of basidiomycetous yeasts as determined by large-subunit rDNA D1/D2 domain sequence analysis. Int. J. Syst. Evol. Microbiol. 50: 1351-1371, 2000.

Physical Characteristics

  • Optimum TemperatureUnknown
  • Miniumum TemperatureUnknown
  • Maximum TemperatureUnknown

Cells

  • ShapeUnknown
  • Min Broth Breadth (µm)5
  • Max Broth Breadth (µm)7
  • Min Broth Length (µm)5
  • Max Broth Length (µm)7
  • Min Agar Breadth (µm)3
  • Max Agar Breadth (µm)7
  • Min Agar Length (µm)4
  • Max Agar Length (µm)7
  • ArrangementUnknown
  • Colour on AgarBrown
  • Surface on AgarShiny
  • Texture on AgarSmooth
  • Deposit in BrothNon-Flocculent
  • Ring in BrothIncomplete
  • Ring ColourUnknown
  • Pellicle in BrothAbsent
  • Pellicle AppearanceUnknown
  • Pellicle HabitatUnknown

Cell Division

  • BuddingMultipolar
  • FissionAbsent

Filamentous Growth

  • PseudomyceliumAbsent
  • Pseudomycelium BranchUnknown
  • Pseudomycelium FormUnknown
  • BlastosporesAbsent
  • Blastospore ShapeUnknown
  • Blastospore LocationUnknown
  • Blastospore HabitatUnknown
  • True MyceliumAbsent
  • Clamp ConnectionsAbsent

Asexual Spores

  • BallistosporesAbsent
  • AthrosporesAbsent
  • EndosporesAbsent
  • ChlamydosporesAbsent

Sexual Spores

  • AscosporesAbsent
  • Ascospore ShapeUnknown
  • Ascospore WallUnknown
  • Ascospores No Per AscusN/A
  • Ascus ShapeN/A
  • ConjugationAbsent
  • TeliosporesAbsent
  • Teliospore ShapeUnknown

Miscellaneous

  • AssayUnknown
  • Salt TolerantUnknown
  • KillerUnknown
  • PlasmidUnknown

Semi-Anaerobic Fermentation

  • Glucose-
  • Galactose-
  • Sucrose-
  • Maltose-
  • Cellobiose-
  • Trehalose-
  • Lactose-
  • Melibiose-
  • Raffinose-
  • Melizitose-
  • Inulin-
  • Soluble Starch-
  • XyloseUnknown
  • AMD Glucoside-

Aerobic Utilisation and Growth - Sole Sources of Nitrogen

  • NH4 2SO4+
  • KNO3+
  • Ethylamine+
  • Cadaverine+
  • LysineUnknown

Other

  • Vitamin Free Growth-
  • Cyclohex 100-
  • Cyclohex 1000-
  • Glucose Growth 50-
  • Glucose Growth 60Unknown
  • Lipolytic-
  • Acid Production-
  • Growth 37-
  • Growth 40-
  • Arbutin Hydrolysis+
  • Urease Activity+
  • Starch Production+
  • Acid TolerantUnknown

Genomic Sequence Data

D1-D2 sequence
AGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGAAAAGCTCAAATTTGAAATCTGGTA
GCCTCAGGCTGCCCGAGTTGTAATCTATAGAAACGTTTTCCGCGTTGGCCCATGTACAAGTCTCCTGGAATGGAGCGTC
ATAGAGGGTGAGAATCCCGTCCTTGACATGGACTACCAATGCTTTGTGATACGTTTTCAAAGAGTCGAGTTGTTTGGGA
ATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGG
GAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAACGATTGAAGTCAGTCATG
TCTATTGGACTCAGCCGGTTCTGCCGGTGTACTTCCTTTAGATGGGGTCAACATCAGTTTTGATCGCTGGAAAAGGGCA
GGAGGAATGTAGCACTCTCGGGTGAACTTATAGCCTTCTGTCGTATACAGTGGTTGGGACTGAGGAACGCAGCATGCCT
TTATGGCCGGGGTTCGCCCACGTACATGCTTAGGATGTTGACATAATGGCTTTAAACGACCCGTCTTG